General information for g10901.t3
Yuki Yoshida
22/1/2022
Gene loci information
Transcript annotation
- This transcript has been annotated as Putative Probable Golgi SNAP receptor complex member 2.
Parent gene
- The parent gene g10901 is located on chr_1: 12536865..12537612 (- strand)
Gene structure
- The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.
| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_1 | g10901 | g10901.t3 | TTS | g10901.t3 | 12536846 | 12536846 |
| chr_1 | g10901 | g10901.t3 | isoform | g10901.t3 | 12536865 | 12537422 |
| chr_1 | g10901 | g10901.t3 | exon | g10901.t3.exon1 | 12536865 | 12537257 |
| chr_1 | g10901 | g10901.t3 | cds | g10901.t3.CDS1 | 12536865 | 12537257 |
| chr_1 | g10901 | g10901.t3 | exon | g10901.t3.exon2 | 12537317 | 12537422 |
| chr_1 | g10901 | g10901.t3 | cds | g10901.t3.CDS2 | 12537317 | 12537358 |
| chr_1 | g10901 | g10901.t3 | TSS | g10901.t3 | 12537683 | 12537683 |
Sequences
>g10901.t3 Gene=g10901 Length=499
CAACTGCGACCGCCTCGATGTTCTCGTATTTAAAGTACCAGCAGCAACTCGCCAGAACTC
AAAAATGAAAGTTGATCAGCTAAAATACGACATTCGACACTTGCAAACCGCTTTGAGCAT
GTATCAACAAAAGAGACAAAAAAGAGAAATGGAAGCTACAGAAAGAGAACAATTATTAAC
AAGAAGATTTCAGCCTAATTCAGAAACAACTATAGATCTTGACTATTCACTTCAACACAA
TACACAAATGCAAAATGCACATAGAGGCGTAGATGAAATGCTTTCTACTGGCAATAATAT
AATTAATAGTTTAAGAAATCAACGAGATATATTGAAAGGTGCTCGTACTAGAATGTTGAA
TGTTGGTAGCACGCTTGGTCTTTCAGACCATACAATAAGGCTAATTGAGAGGAGACTGAC
AGATGATCGATATGTTATGTTTGCAGGAATGTTTGTTACATTATGTATTATTGGCTTAGT
TATTTATCTATTAGCTTAA
>g10901.t3 Gene=g10901 Length=144
MKVDQLKYDIRHLQTALSMYQQKRQKREMEATEREQLLTRRFQPNSETTIDLDYSLQHNT
QMQNAHRGVDEMLSTGNNIINSLRNQRDILKGARTRMLNVGSTLGLSDHTIRLIERRLTD
DRYVMFAGMFVTLCIIGLVIYLLA
Protein features from InterProScan
| Transcript | Database | ID | Name | Start | End | E.value | |
|---|---|---|---|---|---|---|---|
| 10 | g10901.t3 | CDD | cd15863 | SNARE_GS27 | 53 | 117 | 1.55933E-26 |
| 5 | g10901.t3 | Gene3D | G3DSA:1.20.5.110 | - | 47 | 122 | 3.3E-8 |
| 2 | g10901.t3 | PANTHER | PTHR21230 | VESICLE TRANSPORT V-SNARE PROTEIN VTI1-RELATED | 1 | 141 | 2.8E-45 |
| 3 | g10901.t3 | PANTHER | PTHR21230:SF1 | GOLGI SNAP RECEPTOR COMPLEX MEMBER 2 | 1 | 141 | 2.8E-45 |
| 9 | g10901.t3 | PIRSF | PIRSF028865 | Membrin-2 | 1 | 144 | 2.1E-49 |
| 1 | g10901.t3 | Pfam | PF12352 | Snare region anchored in the vesicle membrane C-terminus | 54 | 118 | 1.3E-17 |
| 6 | g10901.t3 | Phobius | CYTOPLASMIC_DOMAIN | Region of a membrane-bound protein predicted to be outside the membrane, in the cytoplasm. | 1 | 122 | - |
| 8 | g10901.t3 | Phobius | TRANSMEMBRANE | Region of a membrane-bound protein predicted to be embedded in the membrane. | 123 | 143 | - |
| 7 | g10901.t3 | Phobius | NON_CYTOPLASMIC_DOMAIN | Region of a membrane-bound protein predicted to be outside the membrane, in the extracellular region. | 144 | 144 | - |
| 4 | g10901.t3 | SUPERFAMILY | SSF58038 | SNARE fusion complex | 57 | 113 | 7.33E-9 |
| 11 | g10901.t3 | TMHMM | TMhelix | Region of a membrane-bound protein predicted to be embedded in the membrane. | 124 | 143 | - |
Transmembrane regions from TMHMM
Disordered region
IUPRED3 score over 0.5 is predictive of a disordered region.
GO terms from InterProScan
| GOID | TERM | ONTOLOGY |
|---|---|---|
| GO:0005484 | SNAP receptor activity | MF |
| GO:0005794 | Golgi apparatus | CC |
| GO:0016192 | vesicle-mediated transport | BP |
KEGG
Orthology
This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).
Expression
Transcript expression in Pv11 cells
TPM values are indicated as average +/- STDEV. 
Differential expression
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below.
