| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_1 | g11466 | g11466.t84 | TTS | g11466.t84 | 16402447 | 16402447 |
| chr_1 | g11466 | g11466.t84 | isoform | g11466.t84 | 16403417 | 16406824 |
| chr_1 | g11466 | g11466.t84 | exon | g11466.t84.exon1 | 16403417 | 16403528 |
| chr_1 | g11466 | g11466.t84 | cds | g11466.t84.CDS1 | 16403418 | 16403528 |
| chr_1 | g11466 | g11466.t84 | exon | g11466.t84.exon2 | 16406585 | 16406824 |
| chr_1 | g11466 | g11466.t84 | cds | g11466.t84.CDS2 | 16406585 | 16406824 |
| chr_1 | g11466 | g11466.t84 | TSS | g11466.t84 | 16407060 | 16407060 |
>g11466.t84 Gene=g11466 Length=352
ATGGATGCGATTAAGAAAAAAATGCAAGCAATGAAGCTTGAGAAGGATAACGCATTAGAT
CGCGCCCTTCTCTGTGAACAGCAAGCTCGTGATGCAAACACACGTGCTGAAAAGGCCGAA
GAAGAGGCCCGCACATTGCAAAAGAAGATCCAAACAATTGAAAATGATTTGGATCAGACA
CAAGAACAAGAGACTCTTGTTAATGGAAAGCTTGAAGAAAAAGAAAAGGCACTTCAAAAT
GCTGAATCAGAAGTCGCTGCTTTGAACCGTCGTATTCAACTTTTGGAAGAAGACCTCGAA
CGTTCTGAAGAGCGTTTGGCATCTGCTACCGCAAAGTTGTCAGAAGCATCAG
>g11466.t84 Gene=g11466 Length=117
MDAIKKKMQAMKLEKDNALDRALLCEQQARDANTRAEKAEEEARTLQKKIQTIENDLDQT
QEQETLVNGKLEEKEKALQNAESEVAALNRRIQLLEEDLERSEERLASATAKLSEAS
| Transcript | Database | ID | Name | Start | End | E.value | |
|---|---|---|---|---|---|---|---|
| 7 | g11466.t84 | Coils | Coil | Coil | 1 | 117 | - |
| 6 | g11466.t84 | Gene3D | G3DSA:1.20.5.340 | - | 1 | 79 | 2.5E-29 |
| 5 | g11466.t84 | Gene3D | G3DSA:1.20.5.340 | - | 80 | 117 | 6.2E-6 |
| 2 | g11466.t84 | PANTHER | PTHR19269:SF53 | TROPOMYOSIN-2 | 1 | 117 | 6.2E-35 |
| 3 | g11466.t84 | PANTHER | PTHR19269 | TROPOMYOSIN | 1 | 117 | 6.2E-35 |
| 1 | g11466.t84 | Pfam | PF12718 | Tropomyosin like | 7 | 116 | 1.8E-23 |
| 4 | g11466.t84 | SUPERFAMILY | SSF57997 | Tropomyosin | 1 | 116 | 7.09E-34 |
IUPRED3 score over 0.5 is predictive of a disordered region.
There are no GO annotations for this transcript.
This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).
TPM values are indicated as average +/- STDEV.
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below. There were no conditions that were differentially expressed