Gene loci information

Transcript annotation

  • This transcript has been annotated as hypothetical.

Parent gene

Gene structure

  • The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.

Chromosome Gene Transcript Category ID Start End
chr_1 g11866 g11866.t31 TTS g11866.t31 18838100 18838100
chr_1 g11866 g11866.t31 isoform g11866.t31 18838463 18839050
chr_1 g11866 g11866.t31 exon g11866.t31.exon1 18838463 18838595
chr_1 g11866 g11866.t31 cds g11866.t31.CDS1 18838463 18838531
chr_1 g11866 g11866.t31 exon g11866.t31.exon2 18838655 18838754
chr_1 g11866 g11866.t31 exon g11866.t31.exon3 18838825 18838933
chr_1 g11866 g11866.t31 exon g11866.t31.exon4 18839032 18839050
chr_1 g11866 g11866.t31 TSS g11866.t31 18839188 18839188

Sequences

>g11866.t31 Gene=g11866 Length=361
ATGGTACAAATTAAGGCAAGAAGGAGATAAAATTCCAAGCGTCGATTTATTCGAAGATTC
TCCTGCTAACAAAATAAATATTGCCGATTTATGTGCTGGCAAAAAAGTTGTTCTGTTTGC
AGTACCAGGAGCATTTACTCCTGGCTGTAGCAAAACACATTTGCCTAGTTACATTCAAAA
AGAATCTGAGCTAAAATCTAGCGGTATCAATGAGATTGTTTGCGTTAGTGTAAACGATCC
TTTTGTTCATGCTGCATGGGGTAACCAATTCAATACTAAAGGCAAAATTCGTATGCTCGC
AGATCCAAATGCAAACTTTTCAAAAGCTGTCGATTTGACTATTGATTTGCCTCCATTGGG
T

>g11866.t31 Gene=g11866 Length=23
MLADPNANFSKAVDLTIDLPPLG

Protein features from InterProScan

No InterPro annotations for this transcript.

Transmembrane regions from TMHMM

Disordered region

IUPRED3 score over 0.5 is predictive of a disordered region.

GO terms from InterProScan

There are no GO annotations for this transcript.

KEGG

Orthology

This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).

Expression

Transcript expression in Pv11 cells

TPM values are indicated as average +/- STDEV.

Differential expression

Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below.

Raw TPM values