General information for g16610.t31
Yuki Yoshida
22/1/2022
Gene loci information
Transcript annotation
- This transcript has been annotated as hypothetical.
Parent gene
- The parent gene g16610 is located on chr_4: 10220610..10225182 (+ strand)
Gene structure
- The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.
| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_4 | g16610 | g16610.t31 | isoform | g16610.t31 | 10218526 | 10221173 |
| chr_4 | g16610 | g16610.t31 | exon | g16610.t31.exon1 | 10218526 | 10218817 |
| chr_4 | g16610 | g16610.t31 | exon | g16610.t31.exon2 | 10220863 | 10220955 |
| chr_4 | g16610 | g16610.t31 | exon | g16610.t31.exon3 | 10221049 | 10221173 |
| chr_4 | g16610 | g16610.t31 | cds | g16610.t31.CDS1 | 10221099 | 10221173 |
| chr_4 | g16610 | g16610.t31 | TTS | g16610.t31 | 10221355 | 10221355 |
| chr_4 | g16610 | g16610.t31 | TSS | g16610.t31 | NA | NA |
Sequences
>g16610.t31 Gene=g16610 Length=510
AAAAATTATTTTAATATCTTAAAATATTGTTTTGAATTATTTTTATACGAAACAAANATT
CCATTGCCTAAAAGTCATGTCAATACGAATTTAGATGGAAGGAGTTCAATTGTGAGTGGT
TTTGGCAGGACAAGTGATAACAGTACACAATCACAATTTTTGAAATATGTTTCACTCTAT
ATTGCTCCAAATTCAGTTTGTAGAAATCTCTATGGATCAGATGTTGTTAAAGATACAAAC
ATTTGTGTTGCAACAACAAATACTGCAAGCACTTGCTCAGGAGATTCTGGAGGACCATTG
ACCACTGTTCTTAATGGAACAAATTATGTTATTGGAATCGTTTCTTTTGGTTTTAAAGAT
TCGTGTCAATTGGGTTATCCTGCTGGATTCACAAGAGTTACGAGTTATCTTGGATGGATT
GAAAGTCGAATTAACATGTCACCAAAATCTGTTGCTTGCAATGTATTACTTTTGATCATC
ATTCAAATTTTTTTGTTTTTTCGTAAATAA
>g16610.t31 Gene=g16610 Length=24
MSPKSVACNVLLLIIIQIFLFFRK
Protein features from InterProScan
| Transcript | Database | ID | Name | Start | End | E.value | |
|---|---|---|---|---|---|---|---|
| 3 | g16610.t31 | Phobius | NON_CYTOPLASMIC_DOMAIN | Region of a membrane-bound protein predicted to be outside the membrane, in the extracellular region. | 1 | 5 | - |
| 4 | g16610.t31 | Phobius | TRANSMEMBRANE | Region of a membrane-bound protein predicted to be embedded in the membrane. | 6 | 22 | - |
| 2 | g16610.t31 | Phobius | CYTOPLASMIC_DOMAIN | Region of a membrane-bound protein predicted to be outside the membrane, in the cytoplasm. | 23 | 24 | - |
| 1 | g16610.t31 | TMHMM | TMhelix | Region of a membrane-bound protein predicted to be embedded in the membrane. | 5 | 22 | - |
Transmembrane regions from TMHMM
Disordered region
IUPRED3 score over 0.5 is predictive of a disordered region.
GO terms from InterProScan
There are no GO annotations for this transcript.
KEGG
Orthology
This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).
Expression
Transcript expression in Pv11 cells
TPM values are indicated as average +/- STDEV. 
Differential expression
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below. There were no conditions that were differentially expressed