General information for g5685.t1
Yuki Yoshida
22/1/2022
Gene loci information
Transcript annotation
- This transcript has been not been annotated.
Parent gene
- The parent gene g5685 is located on chr_2: 11253341..11253663 (- strand)
Gene structure
- The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.
| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_2 | g5685 | g5685.t1 | TTS | g5685.t1 | 11253283 | 11253283 |
| chr_2 | g5685 | g5685.t1 | isoform | g5685.t1 | 11253341 | 11253663 |
| chr_2 | g5685 | g5685.t1 | exon | g5685.t1.exon1 | 11253341 | 11253484 |
| chr_2 | g5685 | g5685.t1 | cds | g5685.t1.CDS1 | 11253341 | 11253484 |
| chr_2 | g5685 | g5685.t1 | exon | g5685.t1.exon2 | 11253562 | 11253663 |
| chr_2 | g5685 | g5685.t1 | cds | g5685.t1.CDS2 | 11253562 | 11253663 |
| chr_2 | g5685 | g5685.t1 | TSS | g5685.t1 | 11254598 | 11254598 |
Sequences
>g5685.t1 Gene=g5685 Length=246
ATGATGCGATACGAGAATGAAGAATTAAAAGACAAGAGTGCTTGTGCAAATATACGAGCT
GATCTCAAAATGTGTTTATTACAAAGTGATTGCTGTAAAATTCAAAAGAAAACACCAAGA
GAATGCCTGAATGCAAACGATGGATCAGTTCCAACAGAATGCCAAGCTCTTAGAAATACA
TTTTTTGAGTGTAAAAGATCAATTCTTGATAATAGAGCAAGATTTAGAGGAAGGAAGGGA
TATTAA
>g5685.t1 Gene=g5685 Length=81
MMRYENEELKDKSACANIRADLKMCLLQSDCCKIQKKTPRECLNANDGSVPTECQALRNT
FFECKRSILDNRARFRGRKGY
Protein features from InterProScan
| Transcript | Database | ID | Name | Start | End | E.value | |
|---|---|---|---|---|---|---|---|
| 2 | g5685.t1 | PANTHER | PTHR28627 | CYTOCHROME C OXIDASE ASSEMBLY FACTOR 5 | 12 | 81 | 0.000 |
| 1 | g5685.t1 | Pfam | PF10203 | Cytochrome c oxidase assembly protein PET191 | 13 | 78 | 0.000 |
| 3 | g5685.t1 | ProSiteProfiles | PS51808 | Coiled coil-helix-coiled coil-helix (CHCH) domain profile. | 28 | 72 | 10.662 |
Transmembrane regions from TMHMM
Disordered region
IUPRED3 score over 0.5 is predictive of a disordered region.
Data is missing for g5685/g5685.t1; file /home/yuki.yoshida/nias/analysis/reanalysis/18_revice/midgebase/iupred3/g5685.t1.fa.iupred3.txt does not exist
GO terms from InterProScan
There are no GO annotations for this transcript.
KEGG
Orthology
- This transcript has been annotated with K18178 (cytochrome c oxidase assembly factor 5)
Pathway
- This transcript belongs to the following pathways
Expression
Transcript expression in Pv11 cells
TPM values are indicated as average +/- STDEV. 
Differential expression
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below.
