General information for g5752.t11
Yuki Yoshida
22/1/2022
Gene loci information
Transcript annotation
- This transcript has been annotated as hypothetical.
Parent gene
- The parent gene g5752 is located on chr_2: 11665148..11666050 (+ strand)
Gene structure
- The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.
| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_2 | g5752 | g5752.t11 | isoform | g5752.t11 | 11657142 | 11658353 |
| chr_2 | g5752 | g5752.t11 | exon | g5752.t11.exon1 | 11657142 | 11657159 |
| chr_2 | g5752 | g5752.t11 | exon | g5752.t11.exon2 | 11657225 | 11657352 |
| chr_2 | g5752 | g5752.t11 | exon | g5752.t11.exon3 | 11658009 | 11658150 |
| chr_2 | g5752 | g5752.t11 | exon | g5752.t11.exon4 | 11658253 | 11658353 |
| chr_2 | g5752 | g5752.t11 | cds | g5752.t11.CDS1 | 11658309 | 11658353 |
| chr_2 | g5752 | g5752.t11 | TSS | g5752.t11 | NA | NA |
| chr_2 | g5752 | g5752.t11 | TTS | g5752.t11 | NA | NA |
Sequences
>g5752.t11 Gene=g5752 Length=389
TTTACGTTTTTGTCAATGATCCAGAGAATCTATTATATGAACATCATCAGAACATTATAT
GGGGTAGACAATATGAACCATTTGTGATTCCATGTAAACCAACATCACCTCAAGTTAGAG
TGGAATTAAAAAATGAAGATGGACAGCACCATTATGTAGGAACATATGACCCAAAACGTG
GATTTATAGTTTCATTTCATGATGTTGAAAGTAGCGGATTTTATGAGTGTTTAATAGCAG
ATGATCCTTCAATTTTCACACAATTTCAAGTAATTATAAATGAACAATTTTTAACATCCA
CCACTACTATTAGCACTACTACTAAATCTTCGTTGGAGCTTCAAATGGGTGATGGAAAGA
ATTATGATGTTAATCCCAGGGGTTTGTGT
>g5752.t11 Gene=g5752 Length=15
MGDGKNYDVNPRGLC
Protein features from InterProScan
No InterPro annotations for this transcript.
Transmembrane regions from TMHMM
Disordered region
IUPRED3 score over 0.5 is predictive of a disordered region.
Data is missing for g5752/g5752.t11; file /home/yuki.yoshida/nias/analysis/reanalysis/18_revice/midgebase/iupred3/g5752.t11.fa.iupred3.txt does not exist
GO terms from InterProScan
There are no GO annotations for this transcript.
KEGG
Orthology
This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).
Expression
Transcript expression in Pv11 cells
TPM values are indicated as average +/- STDEV. 
Differential expression
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below. There were no conditions that were differentially expressed