General information for g6631.t14
Yuki Yoshida
22/1/2022
Gene loci information
Transcript annotation
- This transcript has been annotated as hypothetical.
Parent gene
- The parent gene g6631 is located on chr_2: 17874963..17881137 (- strand)
Gene structure
- The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.
| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_2 | g6631 | g6631.t14 | isoform | g6631.t14 | 17873971 | 17875944 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon1 | 17873971 | 17874102 |
| chr_2 | g6631 | g6631.t14 | TTS | g6631.t14 | 17873978 | 17873978 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon2 | 17874162 | 17874295 |
| chr_2 | g6631 | g6631.t14 | cds | g6631.t14.CDS1 | 17874177 | 17874295 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon3 | 17874357 | 17874502 |
| chr_2 | g6631 | g6631.t14 | cds | g6631.t14.CDS2 | 17874357 | 17874502 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon4 | 17875894 | 17875944 |
| chr_2 | g6631 | g6631.t14 | cds | g6631.t14.CDS3 | 17875894 | 17875943 |
| chr_2 | g6631 | g6631.t14 | TSS | g6631.t14 | 17876690 | 17876690 |
Sequences
>g6631.t14 Gene=g6631 Length=463
TGCTCGTGATTGTCGTCGGCGTAATGGAGGAGGAAGTCGTCGTGGTGGCAGATCTCGAAG
CCGCTCTCGATCGCGTAGATCTCGTAGTCACTCGAGAGATCATAGATACAGTCGTTCACC
AGCAGATCGAACAAGAGATCGCAGATCTCATTCAAGCGACCGTAGATCTGCTTCTGAACT
TAGCGAAACACGAAAAAAAAAACATAGTGACAAGTCATGGAAGAGTTCAAGGACAAATTC
ACCACAGTCAGATAGATCTCGAAGAAGTCGTTCCCAAGACACTCAAGCCTCCAATTCGGA
ACCGCGTAAAGAGTGAAATGAGATTCATTCCGTTGGTAGTTACATCTTTAAGAACATCTA
ATAATTGCCGTATGACTTACGAGAAAAGTGACCTATTCATCAGTCATACATTATATAATA
TAAATTATAGTTTGAATAAATTGATTTATATTATATAAAAAAA
>g6631.t14 Gene=g6631 Length=104
ARDCRRRNGGGSRRGGRSRSRSRSRRSRSHSRDHRYSRSPADRTRDRRSHSSDRRSASEL
SETRKKKHSDKSWKSSRTNSPQSDRSRRSRSQDTQASNSEPRKE
Protein features from InterProScan
| Transcript | Database | ID | Name | Start | End | E.value | |
|---|---|---|---|---|---|---|---|
| 2 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 104 | - |
| 3 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 11 | 33 | - |
| 1 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 34 | 69 | - |
| 4 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 81 | 104 | - |
Transmembrane regions from TMHMM
Disordered region
IUPRED3 score over 0.5 is predictive of a disordered region.
GO terms from InterProScan
There are no GO annotations for this transcript.
KEGG
Orthology
This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).
Expression
Transcript expression in Pv11 cells
TPM values are indicated as average +/- STDEV. 
Differential expression
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below.
