| Chromosome | Gene | Transcript | Category | ID | Start | End |
|---|---|---|---|---|---|---|
| chr_2 | g6631 | g6631.t14 | isoform | g6631.t14 | 17873971 | 17875944 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon1 | 17873971 | 17874102 |
| chr_2 | g6631 | g6631.t14 | TTS | g6631.t14 | 17873978 | 17873978 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon2 | 17874162 | 17874295 |
| chr_2 | g6631 | g6631.t14 | cds | g6631.t14.CDS1 | 17874177 | 17874295 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon3 | 17874357 | 17874502 |
| chr_2 | g6631 | g6631.t14 | cds | g6631.t14.CDS2 | 17874357 | 17874502 |
| chr_2 | g6631 | g6631.t14 | exon | g6631.t14.exon4 | 17875894 | 17875944 |
| chr_2 | g6631 | g6631.t14 | cds | g6631.t14.CDS3 | 17875894 | 17875943 |
| chr_2 | g6631 | g6631.t14 | TSS | g6631.t14 | 17876690 | 17876690 |
>g6631.t14 Gene=g6631 Length=463
TGCTCGTGATTGTCGTCGGCGTAATGGAGGAGGAAGTCGTCGTGGTGGCAGATCTCGAAG
CCGCTCTCGATCGCGTAGATCTCGTAGTCACTCGAGAGATCATAGATACAGTCGTTCACC
AGCAGATCGAACAAGAGATCGCAGATCTCATTCAAGCGACCGTAGATCTGCTTCTGAACT
TAGCGAAACACGAAAAAAAAAACATAGTGACAAGTCATGGAAGAGTTCAAGGACAAATTC
ACCACAGTCAGATAGATCTCGAAGAAGTCGTTCCCAAGACACTCAAGCCTCCAATTCGGA
ACCGCGTAAAGAGTGAAATGAGATTCATTCCGTTGGTAGTTACATCTTTAAGAACATCTA
ATAATTGCCGTATGACTTACGAGAAAAGTGACCTATTCATCAGTCATACATTATATAATA
TAAATTATAGTTTGAATAAATTGATTTATATTATATAAAAAAA
>g6631.t14 Gene=g6631 Length=104
ARDCRRRNGGGSRRGGRSRSRSRSRRSRSHSRDHRYSRSPADRTRDRRSHSSDRRSASEL
SETRKKKHSDKSWKSSRTNSPQSDRSRRSRSQDTQASNSEPRKE
| Transcript | Database | ID | Name | Start | End | E.value | |
|---|---|---|---|---|---|---|---|
| 2 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 104 | - |
| 3 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 11 | 33 | - |
| 1 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 34 | 69 | - |
| 4 | g6631.t14 | MobiDBLite | mobidb-lite | consensus disorder prediction | 81 | 104 | - |
IUPRED3 score over 0.5 is predictive of a disordered region.
There are no GO annotations for this transcript.
This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).
TPM values are indicated as average +/- STDEV.
Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below.