Gene loci information

Transcript annotation

  • This transcript has been annotated as hypothetical.

Parent gene

Gene structure

  • The exon-intron structure of all isoforms are indicated below. CDS regions are colored in green. TSS and TTs that were predicted with CTR-Seq data are indicated in solid circle and squares, respectively. More specific data are shown in the table below.

Chromosome Gene Transcript Category ID Start End
chr_2 g7608 g7608.t29 isoform g7608.t29 24910250 24910572
chr_2 g7608 g7608.t29 exon g7608.t29.exon1 24910250 24910572
chr_2 g7608 g7608.t29 cds g7608.t29.CDS1 24910251 24910322
chr_2 g7608 g7608.t29 TSS g7608.t29 24911300 24911300
chr_2 g7608 g7608.t29 TTS g7608.t29 NA NA

Sequences

>g7608.t29 Gene=g7608 Length=323
CGATAGAATTGATGAATTTAAAAAGATTAACACGGAAGTTATTGCTGCTTCAGTTGATTC
TCATTTTACACATCTATCATGGACAAAGACACCAAGAAAAGAAGGTGGTTTAGGAAATGT
GAAAATTCCTTTGCTGAGCGATTTATCGCATAAAATATCTAAAGATTATGGAGTTTATTT
GGAGGATCTTGGCCATACACTTAGAGGACTTTTCATTATTGATGCAAAAGGTGTTTTACG
TCAGATTACAATGAATGATTTGCCAGTTGGACGTAGTGTCGATGAAACTCTTCGTTTGGT
ACAAGCTTTTCAATATACTGATA

>g7608.t29 Gene=g7608 Length=24
MNDLPVGRSVDETLRLVQAFQYTD

Protein features from InterProScan

Transcript Database ID Name Start End E.value
g7608.t29 Gene3D G3DSA:3.40.30.10 Glutaredoxin 1 24 1.2e-06

Transmembrane regions from TMHMM

Disordered region

IUPRED3 score over 0.5 is predictive of a disordered region.

GO terms from InterProScan

There are no GO annotations for this transcript.

KEGG

Orthology

This gene did not have any KEGG ortholog annotations (KAAS, GHOSTZ).

Expression

Transcript expression in Pv11 cells

TPM values are indicated as average +/- STDEV.

Differential expression

Differentially expressed genes were identified with DESeq2 using the ‘run_DE_analysis.pl’ script from Trinity. Transcripts were determined as differentially expressed when (1) FDR < 0.05 (2) fold change > 2 (TPM calculated by RSEM). DE information and fold change between conditions are indicated in the plot below.

Raw TPM values